Unia Europejska

foto Piotr Ślipiński

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 05.11.2014 r.

numer ogłoszenia 9/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: 13 op. CEQ Separation Gel LPA Beckman Coulter 608010

        Zadanie 2: 7 op. CEQ Separation Buffer, 4/pk Beckman Coulter 608012

        Zadanie 3: 10 op. CEQ DNA Size Standard 400 Beckman Coulter 608098

   Zadanie 4: 11 op. Sample Loading Solution Beckman Coulter 608082

   Zadanie 5: 1 op. Agaroza o wysokiej rozdzielczości DNA, 500 g

   Zadanie 6: 10 szt. Oligonukleotydów, skala syntezy: 0,2 µmol; metoda oczyszczania: odsalanie; zawieszone  w wodzie w stężeniu 100 µM

Nazwa

Sekwencja 5'-3'

Msca43_R

GCTACCGTAGTTAGCTGTTAC

Msca64_R

ACGCGGACGATGTCACGTGC

Msca7_R

AAAGGCGATTAAACGTGGTG

Msca47_R

GAGTAACGGGCCGTTTGTACG

Msca78_R

GGCAAACACGGCACCATGG

Myrt4_R

CGGCGATGCAAGTACGTC

Msca50_R

AGGTAGCGGCTAGCGTGTT

MS86_R

AGTCGTGAGTACAACAT

Msca1_R

CCCGCATTCGCATAGAAATA

MP84_R

AAAGGACAAACGGGAGACGAAC

 

Zadanie 7: 10 szt. Oligonukleotydów WellRED, wydajność syntezy: 2 OD, oczyszczanie: RP1

 

Nazwa

Sekwencja 5'-3'

Msca43_F

[D2]- CGACCGCGCACTTAATCGCG

Msca64_F

[D3]- GTTATCGTCACTATTACTGTCGC

Msca7_F

[D2]- GCTTTAATTCCGGGACACTC

Msca47_F

[D4]- GAACTGGATGCAAAGAGGCGC

Msca78_F

[D3]- CGGGTTAACGTGTTACTGGAG

Myrt4_F

[D3]- CGTGCATGCGAGCATTCCGT

Msca50_F

[D2]- AGCAACGCCACGCGTTACC

MS86_F

[D4]- GATAGCAGATAAAACGA

Msca1_F

[D3]- ACCAGGAAATGAGCCAACAG

MP84_F

[D2]- GCAGTTTAGGCGAGGCTCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

                               

Oryginał do pobrania: TUTAJ

acrobat Zawiadomienie o wyborze Dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie

Konkurs na stanowisko dyrektora Muzeum i Instytutu Zoologii PAN
w Warszawie
na 4-letnią kadencję

 

Działając na podstawie art. 28 ust. 4 punktu 3) ustawy  z dnia  30 kwietnia 2010 r. o Polskiej Akademii Nauk (Dz. U. nr 96  poz. 619) w powiązaniu z § 2 ust. 1 oraz § 14 ust. 1 rozporządzenia  Ministra Nauki i Szkolnictwa Wyższego z dnia  22 listopada 2010 r.  w sprawie konkursu na stanowisko dyrektora instytutu naukowego Polskiej Akademii Nauk  Rada Kuratorów Wydziału II Nauk Biologicznych i Rolniczych  PAN ogłasza  konkurs na stanowisko dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie.

Konkurs składa się z dwóch etapów obejmujących:
1. ocenę formalną zgłoszeń do konkursu oraz ocenę kwalifikacji naukowych /zawodowych kandydatów na podstawie przedstawionych dokumentów;
2.  ocenę wiedzy i predyspozycji kandydatów do kierowania instytutem na podstawie rozmowy kwalifikacyjnej.

WYMAGANIA NIEZBĘDNE:

Kandydatem na stanowisko Dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie może być osoba, która:

  1. posiada co najmniej stopień naukowy doktora nauk biologicznych lub pokrewnych oraz specjalność i znaczący dorobek naukowy w zakresie zoologii;
  2. ma  doświadczenie na stanowisku kierowniczym w sektorze naukowym;
  3. nie była skazana prawomocnym wyrokiem za umyślne przestępstwo lub przestępstwo skarbowe;
  4. korzysta z pełni praw publicznych.

ZGŁOSZENIE KANDYDATA ZAWIERA:

  1. koncepcję funkcjonowania Instytutu opracowaną  przez osobę przystępującą do konkursu w formie prezentacji multimedialnej, złożoną na nośniku elektronicznym;
  2. informację o dotychczasowym przebiegu pracy  zawodowej, w tym o zakresie obowiązków związanych z zajmowanymi stanowiskami i pełnionymi  funkcjami,   okresie ich pełnienia, liczbie podległych pracowników i osiągnięciach zawodowych oraz o posiadanych tytułach lub stopniach naukowych, złożoną   na piśmie w 2 egz.  oraz na nośniku elektronicznym;
  3. poświadczone za zgodność z oryginałem kopie dokumentów potwierdzających:

                  a) przebieg pracy zawodowej;
b) posiadany tytuł lub stopień naukowy;
4.  oświadczenie, że z chwilą objęcia funkcji dyrektora Instytutu, Muzeum i Instytut Zoologii PAN w Warszawie będzie pierwszym miejscem pracy kandydata;
5.   oświadczenie o korzystaniu z pełni praw publicznych;
6.   oświadczenie o niekaralności za umyślne przestępstwo lub przestępstwo skarbowe;
7.   oświadczenie, o którym mowa w art. 7 ust. 1 ustawy z dnia 18 października 2006 r.     o ujawnianiu informacji o dokumentach organów bezpieczeństwa państwa z lat 1944 – 1990 oraz treści tych dokumentów (Dz. U. z 2007 r. Nr 63, poz. 425, z późn. zmianami); 
8.  poświadczoną za zgodność z oryginałem kopię dowodu osobistego lub innego dokumentu potwierdzającego tożsamość,
9.  oświadczenie o wyrażeniu zgody na przetwarzanie danych osobowych w ramach konkursu na stanowisko dyrektora, zgodnie z ustawą z dnia 29 sierpnia 1997 r. o ochronie danych osobowych (Dz.U. nr 133, poz. 883 z późn. zm.)

 

Dokumenty należy nadsyłać  pocztą (w dwóch egzemplarzach) na adres: Wydział II Nauk Biologicznych i Rolniczych PAN, 00-901 Warszawa, Plac Defilad 1 (tel/fax  22 620 33 75) z dopiskiem na kopercie: konkurs na stanowisko dyrektora Muzeum Instytut Zoologii PAN  lub składać osobiście na adres: Wydział II Nauk Biologicznych i Rolniczych PAN, 00-901 Warszawa, Pałac Kultury i Nauki, pokój 2112 (21 piętro) w godz. od 9.00  do 16.00.

Zgłoszenia niekompletne, nie spełniające warunków formalnych oraz przekazane po terminie nie podlegają rozpatrzeniu. O dalszych etapach konkursu kandydaci zostaną powiadomieni pisemnie.

Materiały informacyjne dotyczące funkcjonowania i działalności Muzeum i Instytutu Zoologii PAN w Warszawie dostępne są na stronie internetowej http://www.miiz.waw.pl

 

Ogłoszenie o konkursie opublikowano w dniu 21 listopada 2011 r.
Termin składania zgłoszeń do konkursu wynosi 30 dni liczonych od dnia następującego po dniu ukazania się ogłoszenia o konkursie. O zachowaniu terminu zgłoszenia decyduje data wpływu zgłoszenia.

 

Muzeum i Instytut Zoologii PAN w Warszawie, realizujący projekt "Opracowanie innowacyjnych metod szybkiej identyfikacji nicieni powodujących straty w gospodarce" współfinansowanego przez Unię Europejską ze środków Europejskiego Funduszu Rozwoju Regionalnego zaprasza na:

Praktyki studenckie z zakresu nematologii
Od grudki gleby do barkodingu DNA nicienia

Nicienie są jedną z najliczniejszych grup zwierząt wielokomórkowych, dotychczas opisano ok. 20 tysięcy gatunków. Należą one do różnych grup troficznych; są wśród nich gatunki bakteriożerne, grzybożerne, drapieżne, pasożyty roślin, zwierząt i ludzi. O ile nicienie bakteriożerne, grzybożerne i drapieżne ogrywają znaczącą pozytywna rolę w środowisku glebowym, to wiele gatunków pasożytów roślin może powodować znaczne straty w gospodarce.
Żerowanie nicieni może powodować zamieranie roślin, spadek ich produktywności, doprowadzać do degradacji handlowej produkowanych płodów rolnych, oraz perturbacji w międzynarodowym obrocie produktami roślinnymi, wobec ryzyka
rozprzestrzenienia gatunków kwarantannowych.

Tematyka praktyk obejmuje:

  • Metody pozyskiwania nicieni z gleby i roślin
  • Metody konserwacji i preparatyki nicieni
  • Prezentację i omówienie wybranych grup nicieni
  • Metody ekstrakcji DNA, PCR
  • Demonstrację sekwencjonowania DNA i identyfikacji okazu w BOLD

Osoby biorące udział w praktyce studenckiej otrzymają potwierdzenie uczestnictwa,
Praktyki będą odbywały się w Nematologicznym Centrum Diagnostyczno- Szkoleniowym - siedziba MiIZ PAN, Warszawa, ul. Wilcza 64.

Praktyki są bezpłatne.
Organizator nie zapewnia noclegów

Studenci zainteresowani praktykami proszeni są o kontakt e-mailowy z:
Dr hab. Tadeuszem Malewskim Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript.
Dr Ewą Dmowską Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript.
Dr Grażyną Winiszewską Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript.

Konkurs na stanowisko dyrektora Muzeum i Instytutu Zoologii PAN
w Warszawie
na 4-letnią kadencję rozpoczynającą się w dniu 1 grudnia 2011 r.

Działając na podstawie art. 28 ust. 4 punktu 3) ustawy  z dnia  30 kwietnia 2010 r. o Polskiej Akademii Nauk (Dz. U. nr 96  poz. 619) w powiązaniu z  § 2 ust. 1 rozporządzenia  Ministra Nauki i Szkolnictwa Wyższego z dnia  22 listopada 2010 r.  w sprawie konkursu na stanowisko dyrektora instytutu naukowego Polskiej Akademii Nauk  Komisja Konkursowa powołana przez Radę Kuratorów Wydziału II Nauk Biologicznych i Rolniczych PAN ogłasza nabór kandydatów na stanowisko dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie.

Konkurs składa się z dwóch etapów obejmujących:
1. ocenę formalną zgłoszeń do konkursu oraz ocenę kwalifikacji naukowych /zawodowych kandydatów na podstawie przedstawionych dokumentów;
2.  ocenę wiedzy i predyspozycji kandydatów do kierowania instytutem na podstawie rozmowy kwalifikacyjnej.

WYMAGANIA NIEZBĘDNE:

Kandydatem na stanowisko Dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie może być osoba, która:

  1. posiada co najmniej stopień naukowy doktora nauk biologicznych lub pokrewnych oraz specjalność i znaczący dorobek naukowy w zakresie zoologii;
  2. ma  doświadczenie na stanowisku kierowniczym w sektorze naukowym;
  3. nie była skazana prawomocnym wyrokiem za umyślne przestępstwo lub przestępstwo skarbowe;
  4. korzysta z pełni praw publicznych.

ZGŁOSZENIE KANDYDATA ZAWIERA:

  1. koncepcję funkcjonowania Instytutu opracowaną  przez osobę przystępującą do konkursu w formie prezentacji multimedialnej, złożoną na nośniku elektronicznym;
  2. informację o dotychczasowym przebiegu pracy  zawodowej, w tym o zakresie obowiązków związanych z zajmowanymi stanowiskami i pełnionymi  funkcjami,   okresie ich pełnienia, liczbie podległych pracowników i osiągnięciach zawodowych oraz o posiadanych tytułach lub stopniach naukowych, złożoną   na piśmie w 2 egz.  oraz na nośniku elektronicznym;
  3. poświadczone za zgodność z oryginałem kopie dokumentów potwierdzających:

                  a) przebieg pracy zawodowej;
b) posiadany tytuł lub stopień naukowy;
4.  oświadczenie, że z chwilą objęcia funkcji dyrektora Instytutu, Muzeum i Instytut Zoologii PAN w Warszawie będzie pierwszym miejscem pracy kandydata;
5.   oświadczenie o korzystaniu z pełni praw publicznych;
6.   oświadczenie o niekaralności za umyślne przestępstwo lub przestępstwo skarbowe;
7.   oświadczenie, o którym mowa w art. 7 ust. 1 ustawy z dnia 18 października 2006 r.     o ujawnianiu informacji o dokumentach organów bezpieczeństwa państwa z lat 1944 – 1990 oraz treści tych dokumentów (Dz. U. z 2007 r. Nr 63, poz. 425, z późn. zmianami);  
8.  poświadczoną za zgodność z oryginałem kopię dowodu osobistego lub innego dokumentu potwierdzającego tożsamość,
9.  oświadczenie o wyrażeniu zgody na przetwarzanie danych osobowych w ramach konkursu na stanowisko dyrektora, zgodnie z ustawą z dnia 29 sierpnia 1997 r. o ochronie danych osobowych (Dz.U. nr 133, poz. 883 z późn. zm.)

 

Dokumenty należy nadsyłać  pocztą (w dwóch egzemplarzach) na adres: Wydział II Nauk Biologicznych i Rolniczych PAN, 00-901 Warszawa, Plac Defilad 1 (tel/fax  22 620 33 75) z dopiskiem na kopercie: konkurs na stanowisko dyrektora Muzeum Instytut Zoologii PAN  lub składać osobiście na adres: Wydział II Nauk Biologicznych i Rolniczych PAN, 00-901 Warszawa, Pałac Kultury i Nauki, pokój 2112 (21 piętro) w godz. od 9.00  do 16.00.

Zgłoszenia niekompletne, nie spełniające warunków formalnych oraz przekazane po terminie nie podlegają rozpatrzeniu. O dalszych etapach konkursu kandydaci zostaną powiadomieni pisemnie.

Materiały informacyjne dotyczące funkcjonowania i działalności Muzeum i Instytutu Zoologii PAN w Warszawie dostępne są na stronie internetowej http://www.miiz.waw.pl

 

Ogłoszenie o konkursie opublikowano w dniu 6 września 2011 r.
Termin składania zgłoszeń do konkursu wynosi 30 dni liczonych od dnia następującego po dniu ukazania się ogłoszenia o konkursie. O zachowaniu terminu zgłoszenia decyduje data wpływu zgłoszenia.

 

Dyrekcja Muzeum i Instytut Zoologii PAN (www.miiz.waw.pl)

 poszukuje pracownika do Działu Kadr na stanowisko:

Referent ds. płac

Rekrutacja trwa do dnia 20 lutego 2021

Zakres obowiązków

  1. Sporządzanie list płac, stypendiów oraz innych świadczeń, niezbędnych rejestrów.
  2. Odprowadzanie składek ZUS i podatku dochodowego od osób fizycznych.
  3. Rozliczanie umów o dzieło i umów zlecenie.
  4. Sporządzanie deklaracji do ZUS, Urzędu Skarbowego, GUS.
  5. Ewidencja zwolnień lekarskich.
  6. Wystawianie zaświadczeń o zatrudnieniu i zarobkach.
  7. Udzielanie pracownikom informacji z zakresu ubezpieczeń społecznych.
  8. Prowadzenie spraw związanych z wykorzystaniem środków z zakładowego funduszu świadczeń socjalnych.

Wymagania

  • Wykształcenie min. średnie
  • 2 lata doświadczenia na zbliżonym stanowisku
  • Biegła znajomość pracy na komputerze (MS Office)
  • Umiejętność obsługi urządzeń biurowych
  • Mile widziana znajomość j. angielskiego
  • Mile widziana znajomość programu Kadry i Płace Sage Symfonia
  • Mile widziana znajomość obsługi programu Płatnik,
  • Uczciwość, sumienność, wysoka kultura osobista
  • Chęć uczenia się i otwartość na zmiany
  • Dobra organizacja pracy własnej

Oferujemy:

Stabilne zatrudnienie na umowę o pracę  w wymiarze pełnego etatu

Pakiet prywatnej opieki medycznej

Pakiet socjalny

Informujemy, że skontaktujemy się z wybranymi kandydatami.

Oferty (CV) wraz z informacjami o zakończonych kursach i szkoleniach a także spodziewanym wynagrodzeniem należy składać drogą elektroniczną na adres e-mail: rekrutacja @miiz.waw.pl. Instytut oczekuje na oferty do dnia 20 lutego 2021

Wysyłając zgłoszenie rekrutacyjne do MIIZ PAN z siedzibą w Warszawie przy ul. Wilcza 64 (Pracodawca, Administrator danych), zgadzasz się na przetwarzanie przez Pracodawcę/Administratora danych Twoich danych osobowych zawartych w zgłoszeniu rekrutacyjnym w celu przeprowadzenia rekrutacji na stanowisko wskazane w ogłoszeniu.

Do CV należy dołączyć klauzulę:

Wyrażam zgodę na przetwarzanie moich danych osobowych dla potrzeb niezbędnych do realizacji procesu rekrutacji i zostałam/em poinformowany, o tym, że zgodnie z ustawą z dnia 10 maja 2018 roku o ochronie danych osobowych:

  1. Administratorem Pani/Pana danych osobowych jest Muzeum i Instytut Zoologii Polskiej Akademii Nauk ul. Wilcza 64, Warszawa 00-679;
  2. Administrator przetwarzać będzie dane osobowe w celu realizacji procesu rekrutacji, jednak nie dłużej niż przez 12 miesięcy.
  3. Ma Pani /Pan prawo dostępu do swoich danych oraz do ich poprawiania lub wnioskowanie o ich usunięcie.
  4. Podanie danych jest dobrowolne, lecz niezbędne do wzięcia udziału w procesie rekrutacji.
  5. Jeżeli jest Pan/Pani zainteresowany/a pozostawieniem swoich danych do celów przyszłych rekrutacji prosimy o wyrażenie osobnej zgody w tym celu.
  6. Kontakt z Inspektorem ochrony danych Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript.;
  7. Administrator danych nie planuje udostępnienia danych z wyłączeniem sytuacji udzielenia przez Panią/Pana zgody w treści określonej poniżej.

„Wyrażam zgodę na przetwarzanie przekazanych danych osobowych do celów rekrutacji przez Administratora Danych Osobowych”

………………………………………………

Brak powyższej klauzuli spowoduje, iż nie będą Państwo mogli wziąć udziału w procesie rekrutacyjnym. 

.

OGŁOSZENIE O ROZSTRZYGNIĘCIU KONKURSU
NA STANOWISKO ADIUNKTA

 

W dniu 12 sierpnia 2011 r. został rozstrzygnięty konkurs na stanowisko Adiunkta
w Pracowni Technik Molekularnych i Biometrycznych.

Dokumenty na konkurs złożyła:
Dr Anna Tereba.

Komisja konkursowa Uchwałą z dnia 12 sierpnia 2011 r. jednogłośnie  zarekomendowała  zatrudnienie na stanowisku adiunkta dr Annę Terebę.

Director of the Museum and Institute of Zoology of the Polish Academy of Sciences announces a competition for a postdoctoral position

 

A postdoctoral research assistant position is available at the research group led by Dr hab. Andre E. Moura at the Museum and Institute of Zoology of the Polish Academy of Sciences. The research group is focused on cetacean ecology and evolution, and this position will be part of the NCN funded project titled ”Analysis of micro-evolutionary changes in a host genome in response to multiple viral infections in wild animals”. The project will involve genomic analyses of dolphins in relation to pathogenic infection. The successful candidate will also have the opportunity to participate in other research projects of the group, and will be encouraged to apply for further funding.

The position is available for 2 years and 2 months, and includes a three month probation period. The expected start date is early March 2021, or sooner if the successful candidate is available. The research group is based at the Research Station of the Museum and Institute of Zoology (MIZ), Polish Academy of Sciences in Gdańsk – Górki Wschodnie, and maintains strong links with the main research facilities of the MIZ in Warsaw. Therefore, research visits at the main MIZ facilities in Warsaw may be required as part of the job duties. The Research Station also hosts groups working on canid genomics and avian immunogenetics.

Work description

This position will involve carrying out research work as agreed with the group leader. This may involve all the stages of research, including sample collection, laboratory work, data analysis, and preparation of manuscripts for publication, as well as participation in the supervision of PhD students as a second supervisor and contribution to administrative tasks associated with the project. The work will require learning and development of new laboratory procedures and new methods of data analysis, and therefore strong self-motivation and willingness to learn is essential. The successful applicant will be expected to contribute to grant applications submitted by the group, and will be encouraged to apply for independent funding available for early career researchers. The postdoctoral researcher will thus have the opportunity to propose and explore new research questions within the general remit of the research group.

Requirements

The post-doctoral assistant will have expertise in evolutionary biology, population ecology or bioinformatics. Candidates can have a background (BSc or MSc degree) in biology, zoology, bioinformatics, computer science, or related fields, and a PhD degree (awarded or to be awarded soon) in a relevant area. The PhD degree should have been awarded no earlier than 7 years before the start of employment. Preferably, the candidate must be eligible to work in Poland at the time of appointment. The following essential skills are required:

  1. Experience with preparation of biological samples for molecular biology analyses
  2. Good knowledge of evolutionary theory and/or population genetic theory
  3. Knowledge of command line environments (e.g. Linux, DOS, R);
  4. Experience with custom scripts for biological analyses (e.g. Perl, Python, Shell, R scripts);
  5. Good organisational skills;
  6. Experience with large databases;
  7. Ability to work independently and to communicate with a multi-disciplinary team;

Desirable skills include:

  1. Experience with analysing whole-genome datasets, aligning to reference genomes, SNP detection;
  2. Experience with software for evolutionary genomic analyses;
  3. Experience with online genomic databases;
  4. Good understanding of natural selection theory;
  5. Good understanding of mammalian immune system;
  6. Experience of working in an international team.

Research environment

The research at the MIZ is focused on a broad range of themes in animal biology, including systematics, biogeography, evolutionary biology, ecology and population genetics. Andre Moura’s research group is part of the Laboratory of the Molecular and Biometric Techniques led by Prof. Wieslaw Bogdanowicz, grouping researchers focused on population genetics, phylogeography and evolutionary genomics of a broad range of animal taxa. MIZ laboratories contain modern equipment for genomic analyses, including Pacific Biosciences RSII long-read sequencer and Illumina MiSeq System. The state-of-the-art ancient DNA laboratory carries out work on mammalian palaeogenetics. The Museum’s zoological collection is among the largest and most valuable in Europe.

Employment conditions

Employment period: 26 months, subject to a 3-month probation period. Start date: 1st March 2021, or soon after appointment. The salary is funded by the Polish National Science Centre (NCN).

Documents required in the application

  1. Copy of a PhD certificate
  2. Curriculum vitae including the publication list, with the following statement provided at the end and signed:

 

“I give my consent to the processing of personal data provided in my application documents by the Museum and Institute of Zoology PAS for the purpose of the recruitment process, pursuant to the Personal Data Protection Act of 10 May 2018 (Journal of Laws 2018, item 1000) and in agreement with Regulation (EU) 2016/679 of the European Parliament and of the Council of 27 April 2016 on the protection of natural persons with regard to the processing of personal data and on the free movement of such data, and repealing Directive 95/46/EC (General Data

Protection Regulation; L 119 from 04.05.2016)”.

Applications that do not include this statement won't be considered.

  1. Motivation letter (maximum one page)
  2. A copy of one research paper to be evaluated in the recruitment process
  3. Contact details of two persons who can be contacted for

These documents should be sent to Andre Moura Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript. no later than 29.01. 2021. The title of the message should be “Application for a postdoctoral position in dolphin genomics”. Informal inquiries can also be addressed to Andre Moura.

The interviews of shortlisted candidates will take place in early February at the Research Station of the Museum and Institute of Zoology PAS in Gdańsk-Górki Wschodnie. A Skype interview can be arranged.

The contest will be adjudicated no later than 20.02.2021

Warszawa, 28 czerwca 2011 r.

 

OGŁOSZENIE O ROZSTRZYGNIĘCIU KONKURSU
NA STANOWISKO PROFESORA  NADZWYCZAJNEGO

 

W dniu 17 czerwca 2011 r. został rozstrzygnięty konkurs na stanowisko profesora nadzwyczajnego – specjalistę w zakresie badań nad ekologią i behawiorem ptaków.

Dokumenty na konkurs złożył:
Dr hab. Tomasz Mazgajski.

Komisja konkursowa Uchwałą z dnia 17 czerwca 2011 r. jednogłośnie  zarekomendowała  zatrudnienie na stanowisku profesora nadzwyczajnego dr hab. Tomasza Mazgajskiego.

Dyrektor Muzeum i Instytutu Zoologii PAN ogłasza konkurs na stanowisko adiunkta (post-doc)

TERMIN SKŁADANIA OFERT: 29.01.2021 r.


Poszukujemy pracownika naukowego na stanowisko adiunkta w nowo-utworzonej grupie badawczej kierowanej przez Dr hab. Andre Moura w Muzeum i Instytucie Zoologii PAN. Grupa ta zajmuje się ekologia i ewolucją gatunków z podrzędu Cetacea, a ogłaszane stanowisko dotyczy pracy w projekcie finansowanym przez NCN pod tytułem "Analiza zmian mikroewolucyjnych w genomie gospodarza w odpowiedzi na wielokrotne infekcje wirusowe u dzikich zwierząt". Praca nad projektem będzie obejmować analizy genomiczne delfinów w relacji do infekcji wirusowej. Osoba zatrudniona na tym stanowisku będzie miała również możliwość uczestnictwa w innych projektach badawczych realizowanych przez grupę i będzie zachęcana do starania się o fundusze na dalsze badania.
Okres zatrudnienia na tym stanowisku to 2 lata i 2 miesięcy, włączając 3-miesięczny okres próbny. Planowana data rozpoczęcia pracy to początek marca 2021, lub wcześniejszy termin, w zależności od dostępności kandydatki/kandydata. Siedzibą grupy badawczej jest Stacja Ornitologiczna Muzeum i Instytutu Zoologii (MIZ) PAN w Gdańsku – Górkach Wschodnich. Grupa utrzymuje silny związek z główną siedzibą MIZ PAN w Warszawie i z tego względu wizyty badawcze w Warszawie mogą być wymagane w ramach obowiazków służbowych. W Stacji Ornitologicznej MIZ pracują również grupy badawcze zajmujące się genomiką psowatych oraz immunogenetyką ptaków.

Opis zadań i obowiązków
Osoba zatrudniona na tym stanowisku będzie prowadzić prace badawcze uzgodnione z kierownikiem grupy. Prace te mogą obejmować wszystkie etapy, od zbioru próbek przez prace laboratoryjne i analizę danych po przygotowywanie prac do publikacji, a także udział w opiece nad doktorantami jako promotor pomocniczy i wykonywanie zadań administracyjnych związanych z realizacją projektu. Praca na tym stanowisku będzie wymagała poznawania i opracowywania nowych procedur laboratoryjnych oraz nowych metod analizy danych, dlatego konieczna jest silna motywacja do rozwoju naukowego. Osoba zatrudniona na tym stanowisku będzie uczestniczyła w przygotowywaniu wniosków grantowych składanych przez grupę i otrzyma wsparcie w pracy nad własnymi wnioskami o granty i stypendia dla naukowców na wczesnych etapach kariery. Osoba zatrudniona na tym stanowisku będzie zatem miała możliwość rozwijania nowych kierunków badań w obrębie tematyki badawczej grupy.

Wymagania
Wymagane jest doświadczenie w genomice ewolucyjnej, ekologii populacji lub bioinformatyce. Kandydaci powinni miec wykształcenie (tytuł magistra lub licencjat) w biologii, zoologii, bioinformatyce, informatyce, lub pokrewnej dyscyplinie oraz stopień doktora (nadany lub spodziewany przed rozpoczęciem zatrudnienia) w jednej z tych dziedzin. Stopień doktora powinien być nadany nie wcześniej niż 7 lat przed rozpoczęciem zatrudnienia. Ze wzgledu na koniecznosc szybkiego rozpoczecia pracy na tym stanowisku, kandydaci musza miec prawo do pracy/zezwolenie na prace w Polsce.

Kandydat powinien spełniać następujące wymagania:
1. Doświadczenie z przygotowaniem prob biologicznych do analiz w laboratoriach biologii molekularnej;
2. Dobra znajomość teoretyczna genetyki populacji;
3. Biegłość w poslugiwaniu sie wierszami poleceń, np. Linux/Unix, DOS, R;
4. Umiejetność przygotowywania skryptow do analiz biologicznych (np. Python, Perl, Shell, R scripts);
5. Zdolność do efektywnej organizacji pracy;
6. Doświadczenie w pracy z dużymi bazami danych;
7. Zdolność do samodzielnej pracy i do efektywnej komunikacji z interdyscyplinarnym zespołem. Dodatkowe mile widziane umiejętności:
1. Doświadczenie w analizie całych genomów w odniesieniu do genomów referencyjnych oraz w detekcji SNPów;
2. Doświadczenie w pracy w programami do analiz w dziedzinie genomiki ewolucyjnej;
3. Doświadczenie z internetowymi bazami danych genomicznych;
4. Dobra znajomość teorii doboru naturalnego;
5. Dobra znajomość układu odpornościowego ssaków;
6. Doświadczenie w pracy w międzynarodowych zespołach badawczych.

Badania naukowe w MIZ PAN
Badania w MIZ obejmują szerokie spektrum zagadnień z dziedziny zoologii, w tym systematykę, biogeografię, biologię ewolucyjną, ekologię i genetykę populacji. Grupa Dr Andre Moura należy do Pracowni Technik Molekularnych i Biometrycznych kierowanej przez Profesora Wiesława Bogdanowicza, która grupuje naukowców zajmujących się genetyką populacji, filogeografią i genomiką ewolucyjną szerokiego spektrum gatunków zwierząt. Laboratoria MIZ są wyposażone w nowoczesny sprzęt do sekwencjonowania nowej generacji, w tym sekwenatory Pacific Biosciences RSII Illumina MiSeq System. W nowoczesnym laboratorium antycznego DNA prowadzone są prace nad paleogenetyką ssaków. Kolekcja zoologiczna Muzeum jest jedną z największych i najcenniejszych w Europie.

Warunki zatrudnienia
Okres zatrudnienia: 26 miesięcy, z 3-mięsiecznym okresem próbnym. Termin rozpoczęcia pracy: 1 marca 2021, lub jak najszybciej po otrzymaniu oferty pracy. Pensja jest fundowana przez Narodowe Centrum Nauki.

Dokumenty wymagane we wniosku
1. Kopia dyplomu doktorskiego
2. Curriculum vitae w języku angielskim wraz z listą publikacji oraz z dołączonym na końcu podpisanym oświadczeniem:
„Wyrażam zgodę na przetwarzanie moich danych osobowych przez Muzeum i Instytut Zoologii Polskiej Akademii Nauk w Warszawie w celu uczestnictwa w procesie rekrutacyjnym, zgodnie z Ustawą z dnia 29.08.1997 r. o Ochronie Danych Osobowych: tekst jednolity (Dz. U. 2016 r. poz. 922 z późn. zm.).”
3. List motywacyjny w języku angielskim (nie więcej niż jedna strona);
4. Kopia jednej publikacji do oceny w procesie rekrutacji;
5. Dane kontaktowe do dwóch osób, które można poprosić o opinie o kandydacie.

Dokumenty te powinny zostać wysłane do Andre Moura: Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript. nie później niż 14.02.2020 r. w wiadomości zatytułowanej “Application for a postdoctoral position in dolphin genomics”. Pytania dotyczące tego stanowiska mogą być kierowane do Andre Moura. Rozmowy kwalifikacyjne wybranych kandydatów odbędą się na początku lutego 2021 w Stacji Ornitologicznej Muzeum i Instytutu Zoologii PAN w Gdańsku-Górkach Wschodnich. W razie potrzeby rozmowa może odbyć się przez Skype.

Rozstrzygnięcie konkursu nastąpi do dnia 28.02.2021 r.

Muzeum i Instytut  Zoologii PAN w Warszawie, realizujący projekt "Repozytorium Cyfrowe Instytutów Naukowych" współfinansowanego przez  Unię Europejską ze środków Europejskiego Funduszu Rozwoju Regionalnego zaprasza na:

Praktyki studenckie
z zakresu Praktyka biblioteczna

Główne tematy praktyki to:

 

  1. Opracowanie rzeczowe zbiorów.
  2. Organizacja i prowadzenie zbiorów (katalogów, bibliografii, opracowań dokumentacyjnych).
  3. Zagadnienia udostępniania zbiorów.
  4. Zagadnienia digitalizacji i archiwizacji.

Cele praktyki :

  1. Zaznajomienie studentów z organizacją, zadaniami oraz działalnością biblioteki wynikającą z typu biblioteki naukowej, potrzeb użytkowników oraz środowiska w którym funkcjonuje.
  2. Specjalistyczne przygotowanie studenta do pracy w bibliotece  w zakresie:
    • organizacji zbiorów (książkowych i nieksiążkowych) oraz nabycie umiejętności wykorzystywania ich w różnorodnych formach pracy z czytelnikiem,
    • poznania podstawowych zasad zarządzania zbiorami, organizacji pracy, prognozowania i planowania.
  3. Zapoznanie studentów z problematyką dawnej książki w bibliotece  oraz wskazanie zasad praktycznego postępowania z tego typu zbiorami.
  4. Zaznajomienie studentów z programami informatycznymi istniejącymi i działającymi na rzecz zbiorów bibliotecznych.
  5. Zapoznanie studentów z archiwizacją i digitalizacją zbiorów.

Biblioteka MiIZ PAN jest nie tylko bardzo ważnym elementem procesu naukowego i dydaktycznego, ale także elementem marketingowym, mogącym zachęcić przyszłych studentów do pracy w bibliotece naukowej.

A postdoctoral research assistant position in ecological modelling using GIS is now open in a research group led by Dr Małgorzata Pilot at the Museum and Institute of Zoology of the Polish Academy of Sciences. The research group studies microevolutionary processes in mammalian populations using genetic and ecological approaches. The person employed on the advertised position will be responsible for building ecological models for a project focused on evolutionary consequences of interactions among grey wolves, golden jackals and free-ranging domestic dogs across Eurasia. The position is available for three years, from July 2021. The research group is based at the Research Station of the Museum and Institute of Zoology (MIZ), Polish Academy of Sciences in Gdańsk, Poland.

Work description

This position will involve the analyses of environmental data using GIS and the modelling of the effect of environmental factors on microevolutionary processes in populations of wolves, golden jackals and free-ranging domestic dogs, as well as participation in the supervision of PhD students and contribution to administrative tasks associated with research projects. The successful applicant will be expected to contribute to grant applications submitted by the group, and will be encouraged to apply for independent funding available for early career researchers. The postdoctoral researcher will thus have the opportunity to propose and explore new research questions within the general remit of the research group.

Requirements

The candidates for this position must hold a PhD degree in biological sciences, environmental sciences or a related discipline, and experience in ecological modelling using GIS. The selected candidate should have no more than 7 years of postdoctoral experience at the start time of the employment; maternity leaves and career breaks associated with health problems are not included in this 7-year period. Candidates who do not hold a PhD degree yet, but have an established date of the PhD thesis defence/viva can be also considered. However, holding a PhD will be required at the time of the job commencement. 

The ideal candidate should have the following skills:

  1. very good knowledge of ecological modelling using GIS;
  2. ability to work independently and as a part of an interdisciplinary research team;
  3. experience with scientific writing, evidenced by an authorship of at least one research paper as a first author (which will be evaluated in the selection process);
  4. fluent knowledge of English.

Desirable skills include:

  1. knowledge of population genetics, and in particular landscape genetics;
  2. experience with statistical analyses of biological or environmental data;
  3. knowledge of a programming/scripting language (e.g. R, Python);
  4. experience of working in interdisciplinary research teams.

Research environment

The research at the MIZ is focused on a broad range of themes in animal biology, including systematics, biogeography, evolutionary biology, ecology and population genetics. Małgorzata Pilot’s research group is part of the Laboratory of the Molecular and Biometric Techniques led by Prof. Wieslaw Bogdanowicz, grouping researchers focused on population genetics, phylogeography and evolutionary genomics of a broad range of animal taxa. MIZ laboratories contain modern equipment for genomic analyses, including Pacific Biosciences RSII long-read sequencer and Illumina MiSeq System. The state-of-the-art ancient DNA laboratory carries out work on mammalian palaeogenetics. The Museum’s zoological collection is among the largest and most valuable in Europe. 

Employment conditions

Employment period: 36 months, subject to a 3-month probation period. Start date: 1 July 2021. The salary is funded by the Polish National Science Centre.

Documents required in the application

  1. Copy of a PhD certificate
  2. Curriculum vitae including the publication list, with the following statement provided at the end and signed:

“I agree to the processing of personal data provided in this document for realising the recruitment process pursuant to the Personal Data Protection Act of 10 May 2018 (Journal of Laws 2018, item 1000) and in agreement with Regulation (EU) 2016/679 of the European Parliament and of the Council of 27 April 2016 on the protection of natural persons with regard to the processing of personal data and on the free movement of such data, and repealing Directive 95/46/EC (General Data Protection Regulation).

I also consent to processing of my personal data by  Museum and Institute of Zoology of the Polish Academy of Sciences for the purposes of any future recruitment processes..”

Applications that do not include this statement won’t be considered.

  1. Motivation letter (maximum one A4 page)
  2. A copy of one research paper to be evaluated in the recruitment process
  3. Contact details of two persons who can be contacted for references.

These documents should be sent to Małgorzata Pilot Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript. no later than 31 March 2021. The title of the message should be “Application for a postdoctoral position in ecological modelling”. Informal inquiries can also be addressed to Małgorzata Pilot.

Shortlisted candidates will be invited for an interview, which will take place in April via Skype.

The date of the contest settlement – 30.04.2021

Podkategorie

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi